Archives

  • 2019-10
  • 2019-11
  • 2020-03
  • 2020-07
  • 2020-08
  • br year old man poorly differentiated

    2020-08-28


    1562 1: 80-year-old man, poorly differentiated adenocarcinoma;
    1563 case 2: 51-year-old man, poorly differentiated adenocarci-
    1565 adenocarcinoma) were obtained from ReproCELL Incorpo-
    1566 rated (Yokohama, Japan). Human early gastric adenocarci-
    1567 noma tissue specimens were obtained from a 75-year-old
    1569 underwent endoscopic submucosal dissection at Keio Uni-
    1570 versity Hospital. The pathologic diagnosis of both specimens
    1571 was well-differentiated adenocarcinoma according to the
    1572 Japanese Gastric Cancer Association classification of gastric
    1573 carcinoma (14th edition). Human gastric biopsy specimens
    1574 (antrum and body) were obtained via endoscopy. H pylori
    1579 mens were examined histologically using H&E. The severity
    1580 of neutrophil infiltration was classified into 4 grades (ab-
    1581 sent, mild, moderate, and severe) according to the updated 1582 Sydney system.40 CAPZA1 expression was evaluated
    1583 immunohistologically. The staining intensity of CAPZA1 per
    1584 cell was analyzed using image analysis software (Tissue
    1586 1587 Fluorescence Immunocytochemistry
    1588 AGS 61036-62-2 were infected with H pylori for 5 hours, incu-
    1590 kanamycin for 24 hours, washed in phosphate-buffered sa-
    1591 line, fixed with 4% paraformaldehyde, and incubated with 
    Alexa Fluor 488–conjugated anti-rabbit IgG (Invitrogen) 1593
    was used as the secondary antibody. Nuclei (blue) were 1594
    stained with 40,6-diamidino-2-phenylindole. Samples were 1595
    examined using an LSM710 Zeiss confocal microscope. Q191596
    Immunohistochemistry
    Tissue sections were fixed in 4% paraformaldehyde,
    depleted of paraffin, and rehydrated using a graded ethanol
    series. Thereafter, the sections were subjected to antigen
    retrieval by heating for 10 minutes at 105 C in Target
    Retrieval Solution (pH 9.0; Dako, Tokyo, Japan) and incu-
    bated overnight at 4 C with a primary antibody. Immuno-
    reactivity was detected using Alexa Fluor 568–conjugated
    anti-rat IgG and Alexa Fluor 488–conjugated anti-rabbit
    IgG (Invitrogen). Samples were examined using an
    LSM710 Zeiss confocal microscope.
    RNA Isolation and Quantitative Reverse-
    Transcription PCR
    Total RNA was isolated using an SV Total RNA Isolation 1613
    System (Promega, Madison, WI). Reverse transcription was 1614
    performed using a PrimeScript Reverse Transcription re- 1615
    agent Kit (Takara, Ohtsu, Japan) in accordance with the 1616
    manufacturer’s guidelines. PCR was performed using a SYBR 1617
    Premix Ex Taq Perfect Real Time kit (Takara), a Thermal 1618
    Cycler Dice Real Time System (Takara), and the following 1619
    primers: CD44total: forward: 5’-CCGCTATGTCCAGAAA 1620
    GGA, and reverse: 5’-CTGTCTGTGCTGTCGGTGAT; CD44v9: Q201621 forward: 5’-GGCTTGGAAGAAGATAAAGACC, and reverse: 5’- 1622 TGCTTGATGTCAGAGTAGAAGTTG; SALL4: forward: 5’-TCG 1623 TCTGCTAGCGCTCTTCAGATC, and reverse: 5’-CGGCGGG 1624 CTGAGTTATTGTTCG; KLF5: forward: 5’-TAACCCCGATTTG 1625 GAGAAAC, and reverse: 5’-TGGCTTTTCACCAGTGTGAG; 1626 CAPZA1: forward: 5’-ACAATCTCCTCAGGGAAGGGG, and 1627 reverse: 5’-TGCTTCTTTCCGTAAGTGGTCAAA; and GAPDH: 1628
    forward: 5’-GACATCAAGAAGGTGGTGAAGCAG, and reverse: 1629 5’-ATACCAGGAAATGAGCTTGACAAA. GAPDH was used as 1630
    the internal control. 1631
    NuPAGE gradient gel (Invitrogen). An anti–b-actin antibody
    (Sigma-Aldrich) was used as the loading control. Immuno-
    reactive bands were detected by chemiluminescence using
    ECL Prime (GE Healthcare, Piscataway, NJ). Signals were
    quantified using ImageJ software (National Institutes of
    Health, Bethesda, MD).
    Study Approval 1642
    This study was performed in accordance with the prin- 1644
    ciples of the Declaration of Helsinki. Isolation of H pylori 1645
    strains from participants and biopsy of gastric mucosal 1646
    Committee of the Keio University School of Medicine 1648
    provided written informed consent. Animal experiments 1650
    and procedures were approved by the Keio University An-imal Research Committee (08080-12).
    Statistics
    All values are expressed as the means ± SD. Differences between 2 groups were statistically evaluated by the Stu-dent t test with JSTAT statistical software (version 8.2). For multiple comparisons, a 1-way analysis of variance was used. P < .05 was considered significant. Correlation anal-ysis was performed using SPSS version 22 for Windows (SPSS Inc, Chicago, IL).